View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19418_low_25 (Length: 332)
Name: NF19418_low_25
Description: NF19418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19418_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 32903271 - 32902957
Alignment:
| Q |
1 |
tcttaaggttttgactcgagatgtggtgtcttcgtctctcttagtattggatcattgattcgttgttgtcccctggattttaatctaacaagtgatatgg |
100 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||| | |
|
|
| T |
32903271 |
tcttaaggttttaactcgagatatggtgtcttcgtctctcgtagtattggatcattgattcgttgttgccccctggatttt---ctaacaagtgatatcg |
32903175 |
T |
|
| Q |
101 |
gagtttgattggacttgttgggggagaaaaacactcgcaaatgggtatacannnnnnnnagaggaacaaatggttatacataataattgcatatgatcaa |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32903174 |
gagtttgattggacttggtgggggagaaaaacactcgcaaatgggtatacattttttttagaggaacaaatggttatacataataattgcatatgatcaa |
32903075 |
T |
|
| Q |
201 |
aataactcccaatcaaatattgattgtgaaagaatttaattaggggaagcatgcatattgattttgaaaagaatctctcatgggtaaagatgatttctat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32903074 |
aataactcccaatcaaatattgattgtgaaagaatttaattaggggaagcatgcatattgattttgaaaagaatctctcatgggtaaagatgatttctat |
32902975 |
T |
|
| Q |
301 |
ttgagctgtgtttgaatt |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32902974 |
ttgagctgtgtttgaatt |
32902957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University