View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19418_low_27 (Length: 315)
Name: NF19418_low_27
Description: NF19418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19418_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 45 - 300
Target Start/End: Complemental strand, 43555078 - 43554822
Alignment:
| Q |
45 |
tttgataaattactaaccatctnnnnnnntttatcagatgaattggaactaatttttaaatttttattgttagatgaattgaatagatttaacttttgat |
144 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43555078 |
tttgataaattactaaccatctaaaaaaattaatcagatgaattggaactaatttttaaattattattgttagatgaattgaatagatttaactttagat |
43554979 |
T |
|
| Q |
145 |
gaattgcatatatgtgaagagatgaatatatttaccaccctacttttaaactcttagta-nnnnnnnnnnnnnnaaagaactct-gtgtttcttttgttg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||| |
|
|
| T |
43554978 |
gaattgcatatatgtgaagagatgaatatatttaccaccctacttttaaactc-tagtattttttattttttttaaagaactctagtgtttcttttgttg |
43554880 |
T |
|
| Q |
243 |
tttttataattccgttgtatggtttaacaagcgattatgacataaacatcgtaaaaga |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43554879 |
tttttataattcggttgtatggtttaacaagcgattatgacataaacatcgtaaaaga |
43554822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University