View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19418_low_36 (Length: 261)
Name: NF19418_low_36
Description: NF19418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19418_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 1499604 - 1499361
Alignment:
| Q |
1 |
ttggagggttaggggtgcagattgaaaccctgtggaacggttcagttgtaaactggatcgtagtatttcaagaaagttttgtactttgtaaccataaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1499604 |
ttggagggttaggggtgcagattgaaaccctgtggaacggttcagttgtaaactggatcgtagtatttcaagaaagttttgtactttgtaaccataaatc |
1499505 |
T |
|
| Q |
101 |
actacatactagaaaagtataacagtcactctgctgtgagatatataggcacaattggccgaactctatgatcaatagtcgtatcatttgataaggttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1499504 |
actacatactagaaaagtataacagtcactctgctgtgagatatataggcacaa-tggccgaactctatgatcaatagtcgtatcatttgataaggttag |
1499406 |
T |
|
| Q |
201 |
catttcgtgctcaaaataacacgaaataacaattggtcgaactct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1499405 |
catttcgtgctcaaaataacacgaaataacaattggtcgaactct |
1499361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University