View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19418_low_39 (Length: 241)
Name: NF19418_low_39
Description: NF19418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19418_low_39 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 50081099 - 50080876
Alignment:
| Q |
18 |
caactcacttctgtggttggtcttggttcaattgttgataatcgcaagttcctcgtgctcttggtccattgttgatgatccttcgagctccctggtgacc |
117 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50081099 |
caactcacttgtgtggttgctcttggttcaattgttgataatcgcaagttcctcgtgctcttggtccattgttgatgatccttcgagctccctcgtgacc |
50081000 |
T |
|
| Q |
118 |
caacactcagactatacttcacttattttaattttagaaaaataaacacaataaagatggttgaattgtagtttaaaaatattttctttgaaactgttga |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50080999 |
caatactcagactatacttcacttattttaattttagaaaaataaacacaataaagatggttgaattgtagtttaaaaatattttctttgaaactgttga |
50080900 |
T |
|
| Q |
218 |
attaaaaattgagtgataaacaat |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50080899 |
attaaaaattgagtgataaacaat |
50080876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University