View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19418_low_41 (Length: 235)
Name: NF19418_low_41
Description: NF19418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19418_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 26 - 222
Target Start/End: Original strand, 20806705 - 20806901
Alignment:
| Q |
26 |
acctacgatgttttttctcactttgacaatgtaaccaccgtctggtatttagctggctttgaagttcaacgaaagacacattgccatttgcaaaatgaat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20806705 |
acctacgatgttttttctcactttgacaatgtaaccaccgtctggtatttagctggctttgaagttcaacgaaagacacattgccatttgcaaaatgaat |
20806804 |
T |
 |
| Q |
126 |
ctagttctagtttattacactaaacatagtttcttcaattaatcactcattttccaccagaacacattcacctcattcactcattgaattctctgct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20806805 |
ctagttctagtttattacactaaacatagtttcttcaatcaagcactcattttccaccagaacacattcacctcattcactcgttgaattctctgct |
20806901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University