View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19418_low_44 (Length: 213)
Name: NF19418_low_44
Description: NF19418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19418_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 82 - 195
Target Start/End: Original strand, 9931057 - 9931173
Alignment:
| Q |
82 |
aactttaaattaaatcagtacaaattattcatattcnnnnnnncttt---cttctttggtttgcatggtccttcttacaaaatttaactatttctagatg |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9931057 |
aactttaaattaaatcagtacaagttattcatattcttttttttttttttcttctttggtttgcatggtccttcttacaaaatttaactatttctagatg |
9931156 |
T |
|
| Q |
179 |
attgtagttttaagcct |
195 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9931157 |
attgtagttttaagcct |
9931173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 50
Target Start/End: Original strand, 9931035 - 9931065
Alignment:
| Q |
20 |
tcactaaagagaatccttggctaactttaaa |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9931035 |
tcactaaagagaatccttggctaactttaaa |
9931065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University