View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19419_high_4 (Length: 238)
Name: NF19419_high_4
Description: NF19419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19419_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 36 - 219
Target Start/End: Complemental strand, 40937804 - 40937621
Alignment:
| Q |
36 |
tttatgagcaaatgtagaaatgaaccttgttggtagaatgaggaatgatgagggaatgtaattgattggagaagttgtggaagtgttgttgagggattcg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40937804 |
tttatgagcaaatgtagaaatgaaccttgttggtagaatgaggaatgatgagggaatgtaattgattggagaagttgtggaagtgttgttgagggattcg |
40937705 |
T |
|
| Q |
136 |
cggagctgagagaatcgaggttccggaaatggtacctggaacacgggagaaaagcttatggaagaacattgataaggatttttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40937704 |
cggagctgagagaatcgaggttccggaaatggtaactggaacacgggagaaaagcttatggaagaacattgataaggatttttg |
40937621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University