View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19421_high_28 (Length: 298)
Name: NF19421_high_28
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19421_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 62 - 273
Target Start/End: Complemental strand, 45342084 - 45341873
Alignment:
| Q |
62 |
atgattgaatcgttgtttcagtgtagtggtgttgttatgctattttttcggttatgtgcgtatgtatgtttgttgaatcgtatattgaacatttgtttgt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342084 |
atgattgaatcgttgtttcagtgtagtggtgttgttatgctattttttcggttatgtgcgtatgtatgtttgttgaatcgtatattgaacatttgtttgt |
45341985 |
T |
|
| Q |
162 |
ttttgtcgttatgcgtaccgttactacaggattgggatttggtggtggtggtggggctcgtactggaacgttgatgtctttgtcgtatttgttggggttt |
261 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341984 |
ttttgtcgttatgcgtaccgttattacaggattgggatttggtggtggtggtggggctcgtactggaacgttgatgtctttgtcgtatttgttggggttt |
45341885 |
T |
|
| Q |
262 |
gaggaagaaggt |
273 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45341884 |
gaggaagaaggt |
45341873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 14 - 67
Target Start/End: Complemental strand, 45342169 - 45342116
Alignment:
| Q |
14 |
ttctctttccaaaaatcactgttaatttgtagattcattgctattgctatgatt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342169 |
ttctctttccaaaaatcactgttaatttgtagattcattgctattgctatgatt |
45342116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University