View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19421_high_31 (Length: 285)

Name: NF19421_high_31
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19421_high_31
NF19421_high_31
[»] chr2 (1 HSPs)
chr2 (19-265)||(17799787-17800033)


Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 17800033 - 17799787
Alignment:
19 cttactctcttcactagagaattcaaaccattgttgcgactcatatccacctcgttcagacgacgttgaaactattctgaacgtgtcgttttgatcggga 118  Q
    ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
17800033 cttacgctcttcactagagaatccaaaccattgttgcgactcatatccacctcgttcagacgacgttgaaactattcggaacgtgtcgttttgatcggga 17799934  T
119 atgacgttgttggtggtggtttgctgaggtgttgatggttcttcatcgtcgtatcgtcgagcgaagacgccgaaaaggatggcgagaacgacgaggagaa 218  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
17799933 atgacgttgttgttggtggtttgatgaggtgttgatggttcttcatcgtcgtttcgtcgagcgaagacgccgaaaaggatggcgagaacgacgaggagaa 17799834  T
219 tgttgagggagttccagctggttttgactttgacggaggaggtatgt 265  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||    
17799833 tgttgagggagttccagctggttttgactttgacgaaggaggtatgt 17799787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University