View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19421_high_34 (Length: 266)
Name: NF19421_high_34
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19421_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 33 - 256
Target Start/End: Original strand, 44056988 - 44057211
Alignment:
| Q |
33 |
ctaaatttgaaagaatatggttgaagtccagttcatggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44056988 |
ctaaatttgaaagaatatggttgaagtccagttcttggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatt |
44057087 |
T |
 |
| Q |
133 |
tttcgtttttgctttgtttgacgaaaattagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaagtgggaat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44057088 |
tttcgtttttgctttgtttgacgaaaattagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaattgggaat |
44057187 |
T |
 |
| Q |
233 |
tcaagttaaattctacggcctatg |
256 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44057188 |
tcaagttaaattctacggcctatg |
44057211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University