View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19421_low_16 (Length: 380)
Name: NF19421_low_16
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19421_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 129 - 353
Target Start/End: Original strand, 31041145 - 31041371
Alignment:
| Q |
129 |
ccaatcccaaacactcta---acgtggtttgctagttgtaatgcattcgaatagtattatatgaatcgtctgattaagatcacattgtttagattttaat |
225 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31041145 |
ccaatcccaaacactctctctacctggtttgctagttgtaatgcattcgaatagtattatatgaatcgtctgattaagatcacattttttagattttaat |
31041244 |
T |
 |
| Q |
226 |
ggtgtcataccttgatttagtggtttgtcttattaagaataaatggttgagatcatgtgactgcattaatgcatgattatctcgaccttaaggaattcat |
325 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31041245 |
ggtgtcataccttgacttac-ggtttgtcttattaagaataaatggttgagatcatgtgactgcattaatgcatgattatctcgaccttaaggaattcat |
31041343 |
T |
 |
| Q |
326 |
ttctctccgactccaaaacacctatgct |
353 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31041344 |
ttctctccgactccaaaacacctatgct |
31041371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University