View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19421_low_27 (Length: 310)
Name: NF19421_low_27
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19421_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 114 - 302
Target Start/End: Complemental strand, 611863 - 611675
Alignment:
| Q |
114 |
tttattatgtcataaacttatgatggtgtttaggtgtaatttgcaaaacacgcttttggtctgatattttgttgttcacaacattcctttcatcattttg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
611863 |
tttattatgtcataaacttatgatggtgtttaggtgtaatttgcaaaacacccttttggtctgatattttgttgttcacaatattcctttcatcattttg |
611764 |
T |
|
| Q |
214 |
gatagaaataaatggccacttaccctttttgtcaaaagctatgggctgaataatttttctttcctttcacgcttttgaatagaattatc |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
611763 |
gatagaaataaatggccacttaccttttttgtcaaaagctatgggctgaataatttttctttcctttcacgcttttgaatagaattatc |
611675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 12 - 122
Target Start/End: Complemental strand, 612159 - 612049
Alignment:
| Q |
12 |
ttggtacatgttcgtgttttcatggctcccaatttgttcaaacataaccaacgttgatatgcatatagcagctattcttcccaacatgtaccaaacacag |
111 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
612159 |
ttggtacatgttcgagttttcatggcttccaatttgttcaaacataaccaacgttgatatgcatatagcagctattcttcccaacatgtaccaaacacaa |
612060 |
T |
|
| Q |
112 |
catttattatg |
122 |
Q |
| |
|
||||||||||| |
|
|
| T |
612059 |
catttattatg |
612049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University