View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19421_low_31 (Length: 285)
Name: NF19421_low_31
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19421_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 17800033 - 17799787
Alignment:
| Q |
19 |
cttactctcttcactagagaattcaaaccattgttgcgactcatatccacctcgttcagacgacgttgaaactattctgaacgtgtcgttttgatcggga |
118 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17800033 |
cttacgctcttcactagagaatccaaaccattgttgcgactcatatccacctcgttcagacgacgttgaaactattcggaacgtgtcgttttgatcggga |
17799934 |
T |
 |
| Q |
119 |
atgacgttgttggtggtggtttgctgaggtgttgatggttcttcatcgtcgtatcgtcgagcgaagacgccgaaaaggatggcgagaacgacgaggagaa |
218 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17799933 |
atgacgttgttgttggtggtttgatgaggtgttgatggttcttcatcgtcgtttcgtcgagcgaagacgccgaaaaggatggcgagaacgacgaggagaa |
17799834 |
T |
 |
| Q |
219 |
tgttgagggagttccagctggttttgactttgacggaggaggtatgt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17799833 |
tgttgagggagttccagctggttttgactttgacgaaggaggtatgt |
17799787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University