View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19421_low_36 (Length: 237)
Name: NF19421_low_36
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19421_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44056891 - 44056671
Alignment:
| Q |
1 |
atgaaagagtcctctcttaggattggatataacaggacgtgaaagttatatagcaatagaggattaacaacgnnnnnnnntatggccgataaaagaaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
44056891 |
atgaaagagtcctctcttaggattggatataacaggacgtgaaagttatatagcaatagtggattaacaacgaaaaaa--tatggccgataaaagaaaca |
44056794 |
T |
|
| Q |
101 |
aaacagatgattatatagtgtgttatgcaccagccatgataacaacgaatggaatatggcaaggagatagccctttggaattttctctgccacttttcat |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44056793 |
aaacaggtgattatatagtgtgttatgcaccagccatgataacaacgaatggaatatggcaaggagatagccctttggaattttctctgccacttttcat |
44056694 |
T |
|
| Q |
201 |
cttacaattaaccttagttgttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44056693 |
cttacaattaaccttagttgttg |
44056671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 39238708 - 39238650
Alignment:
| Q |
118 |
gtgtgttatgcaccagccatgataacaacgaatggaatatggcaaggagatagcccttt |
176 |
Q |
| |
|
||||||||| ||||| | ||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
39238708 |
gtgtgttattcaccaactatgataacaacaaatggaatatggcaaggagataacccttt |
39238650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University