View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19421_low_36 (Length: 237)

Name: NF19421_low_36
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19421_low_36
NF19421_low_36
[»] chr3 (1 HSPs)
chr3 (1-223)||(44056671-44056891)
[»] chr8 (1 HSPs)
chr8 (118-176)||(39238650-39238708)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44056891 - 44056671
Alignment:
1 atgaaagagtcctctcttaggattggatataacaggacgtgaaagttatatagcaatagaggattaacaacgnnnnnnnntatggccgataaaagaaaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||        ||||||||||||||||||||    
44056891 atgaaagagtcctctcttaggattggatataacaggacgtgaaagttatatagcaatagtggattaacaacgaaaaaa--tatggccgataaaagaaaca 44056794  T
101 aaacagatgattatatagtgtgttatgcaccagccatgataacaacgaatggaatatggcaaggagatagccctttggaattttctctgccacttttcat 200  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44056793 aaacaggtgattatatagtgtgttatgcaccagccatgataacaacgaatggaatatggcaaggagatagccctttggaattttctctgccacttttcat 44056694  T
201 cttacaattaaccttagttgttg 223  Q
    |||||||||||||||||||||||    
44056693 cttacaattaaccttagttgttg 44056671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 39238708 - 39238650
Alignment:
118 gtgtgttatgcaccagccatgataacaacgaatggaatatggcaaggagatagcccttt 176  Q
    ||||||||| ||||| | ||||||||||| |||||||||||||||||||||| ||||||    
39238708 gtgtgttattcaccaactatgataacaacaaatggaatatggcaaggagataacccttt 39238650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University