View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19421_low_38 (Length: 223)
Name: NF19421_low_38
Description: NF19421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19421_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 7942472 - 7942663
Alignment:
| Q |
15 |
aaaggaagcaggaaacatcaaggtacaaattggtcttatttttcactgaattaaaatagcaatatacttgaattagctatataaattggtattattttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7942472 |
aaaggaagcaggaaacatcaaggtacaaattggtcttatttttcactgaattaaaatagctatgtacttgaattagctatataaattggtgttattttgt |
7942571 |
T |
 |
| Q |
115 |
tcccatcagaggtttctcccatctgaattcgggatcgacgttgaccgtcaccatgccgttgagccggtagctagcttttttgggcaaaaagc |
206 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7942572 |
tcctatcagaggtttctcccatctgaattcgggatcgacgttgaccgtcaccatgctgttgagccggtagctagcttttttgggcaaaaagc |
7942663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University