View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19422_low_3 (Length: 295)
Name: NF19422_low_3
Description: NF19422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19422_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 10 - 280
Target Start/End: Original strand, 42548644 - 42548915
Alignment:
| Q |
10 |
catcatcaatagtggatcttttcgaaaaaattattctggaaagcttacatttagagtcttcatcacttgttttaccgctacttttggaggtctaattttc |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42548644 |
catcatcaatagtggatctcttcgaaaaaattattctggaaagcttacatttagagtcttcatcacttgttttaccgctacttttggaggtctaattttc |
42548743 |
T |
 |
| Q |
110 |
ggctatgatattggcatctcaggtatacattcaatctctttttacattcttttttctttgatgaaatcaaactccagggtttatatttgatctcccaatc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42548744 |
ggctatgatattggcatctcaggtatacattcaatctctttttacattcttttttctttgatgaaatcaaactccagggtttatatttgatctcccaatc |
42548843 |
T |
 |
| Q |
210 |
actcgatttcataactttttca-cccccaatcatcaaatcatccccttagaatgaggccactattagtaaat |
280 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42548844 |
actcgatttcataactttttcaccccccaatcatcaaatcatccccttagaatgaagccactattagtaaat |
42548915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 90 - 138
Target Start/End: Complemental strand, 18235767 - 18235719
Alignment:
| Q |
90 |
cttttggaggtctaattttcggctatgatattggcatctcaggtataca |
138 |
Q |
| |
|
|||| |||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
18235767 |
ctttcggaggtttaatttttggctatgaccttggcatctcaggtataca |
18235719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University