View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19423_low_2 (Length: 313)
Name: NF19423_low_2
Description: NF19423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19423_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 10 - 297
Target Start/End: Complemental strand, 6157747 - 6157460
Alignment:
| Q |
10 |
attatactgagtattaaaattaaaatttcaaactattgttaccttagtaattactatatgtttttgttttgtttggaaagaatgatgattttggttattg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6157747 |
attatactgagtattaaaattaaaatttcaaactattgttaccttagtaattactatatgtttttgttttgtttggaaagaatgatgattttggttattg |
6157648 |
T |
 |
| Q |
110 |
gatcatatttgcagagggaaaggggaagagtgtgagaagctatcaaagcaataaggtagcaactaggtttagttttcaagagctttcaaaggtgacagga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6157647 |
gatcatatttgcagagggaaaggggaagagtgtgagaagctatcaaagcaataaggtagcaactaggtttagttttcaagagctttcaaaggtgacagga |
6157548 |
T |
 |
| Q |
210 |
ggttttaatgaattgattggcgaaggtggttttggaagagtttacaagggtcgtctccaaaccggcgaggtaacttttaggactttgt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
6157547 |
ggttttaatgaattgattggcgaaggtggttttggaagagtttacaagggtcgtctccaatctggcgaggtaacttttaggactttgt |
6157460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 169 - 297
Target Start/End: Original strand, 17966165 - 17966293
Alignment:
| Q |
169 |
caactaggtttagttttcaagagctttcaaaggtgacaggaggttttaatgaattgattggcgaaggtggttttggaagagtttacaagggtcgtctcca |
268 |
Q |
| |
|
||||||| ||||||||| | ||||||||| |||||||| | |||||| |||||||| || |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17966165 |
caactagttttagttttggatagctttcaatggtgacagaaaattttaaggaattgataggggaaggtggttttggaagagtttacaagggttgtctccc |
17966264 |
T |
 |
| Q |
269 |
aaccggcgaggtaacttttaggactttgt |
297 |
Q |
| |
|
|||||| | ||||||||||||||| |||| |
|
|
| T |
17966265 |
aaccggtgtggtaacttttaggacgttgt |
17966293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 212 - 293
Target Start/End: Complemental strand, 56021267 - 56021186
Alignment:
| Q |
212 |
ttttaatgaattgattggcgaaggtggttttggaagagtttacaagggtcgtctccaaaccggcgaggtaacttttaggact |
293 |
Q |
| |
|
|||||| |||||| | || | ||||||||||||||| ||||||||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
56021267 |
ttttaaggaattgctgggggtaggtggttttggaagtgtttacaagggtcgtctcccaaacggcgaggtaacttttaagact |
56021186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University