View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19424_high_5 (Length: 523)
Name: NF19424_high_5
Description: NF19424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19424_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 476; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 476; E-Value: 0
Query Start/End: Original strand, 16 - 503
Target Start/End: Complemental strand, 4446849 - 4446362
Alignment:
| Q |
16 |
tttactaccaaccaatgctcaaagaatcaatcaaccgtttcttaaccgaataccgcaacggtgctactaatttcaccgatttcacctcaatcttctcccg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4446849 |
tttactaccaaccaatgctcaaagaatcaatcaaccgtttcttaaccgactaccgcaacggtgctactaatttcaccgatttcacctcaatcttctcccg |
4446750 |
T |
|
| Q |
116 |
cgcaattcacaccacttcagacccaccaattccacttctgtggttctattcagcacttgaatttcatactaataggttaagagaagcttctagaacttca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4446749 |
cgcaattcacaccacttcagacccaccaattccacttctgtggttctattcagcacttgaatttcatactaataggttaagagaagcttctagaacttca |
4446650 |
T |
|
| Q |
216 |
ctcgtggcggttaagggtttgtttcagctgcttgtttcgtgttgcgatggatgtgtcgcgatgaagaggatcggggttttagctccgctggtgtttgaga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4446649 |
ctcgtggcggttaagggtttgtttcagctgcttgtttcgtgttgcgatggatgtgtcgcgatgaagaggatcggggttttagctccgttggtgtttgaga |
4446550 |
T |
|
| Q |
316 |
tttatcgttctatgggttgtggggaagaagtgaagagtgaaatcgagggtttggtggaaggggttgtgagttactgtagcatttattgtatgaagagtga |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4446549 |
tttatcgttctatgggttgtggggaagaagtgaagagtgaaattgagggtttggtggaaggggttgtgagttactgtagcatttattgtatgaagagtga |
4446450 |
T |
|
| Q |
416 |
agttgaggttaatggtggtgatgctagggttggggttttggaagagggttttgttgatttgataccggtttggatggttgattgtgac |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4446449 |
agttgaggttaatggtggtgatgctagggttggggttttggaagagggttttgttgatttgataccggtttggatggttgattgtgac |
4446362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University