View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19424_low_10 (Length: 240)
Name: NF19424_low_10
Description: NF19424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19424_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 2119089 - 2118963
Alignment:
| Q |
18 |
gaagatgatttagagggtggtgttttaacttgttttgttttatgtttgttggnnnnnnnttgtgctgcgttccttttttataatattttgttgttttata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2119089 |
gaagatgatttagagggtggtgttttaacttgttttgttttatgtttgttggaaaaaaattgcgctgtgttccttttttataatattttgttgttttata |
2118990 |
T |
 |
| Q |
118 |
aaactaagtaataagtatgttgtccaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2118989 |
aaactaagtaataagtatgttgtccaa |
2118963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 147 - 240
Target Start/End: Complemental strand, 2118920 - 2118828
Alignment:
| Q |
147 |
aaaatattgttcatctaatttattcgcttatttatatnnnnnnngaagtcaatagccatcgatagttggtagtcctgtccatcaacaagctagt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2118920 |
aaaatattgttcatctaatttattcgcttatttatataaaaaa-gaagtcaatagccatcgatagttggtagtcctgtccatcaacaagctagt |
2118828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University