View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19424_low_8 (Length: 380)
Name: NF19424_low_8
Description: NF19424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19424_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 43568745 - 43568473
Alignment:
| Q |
19 |
ttgaaaaggaaagaaatgctgtggatgtttccaggattatcaaggaggagaaggcgggaaccgcggaatgggtggtcggcttttctagaaacttctagaa |
118 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568745 |
ttgaataggaaggaaatgctgtggatgtttccaggattatcaaggaggagaaggcgggaaccgcggaatgggtggtcggcttttctagaaacttctagaa |
43568646 |
T |
|
| Q |
119 |
cacggatgtagttgtgtcttgatttgaatttcgctagtgtttttacgtctttgaatgggatgaagtcttcttgggatttgggttgtttttgttg------ |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568645 |
cacggatgtagttgtgtcttgatttgaatttcgctagtgtttttacgtctttgaatgggatgaagtcttcttgggatttgggttgtttttgttgttggtg |
43568546 |
T |
|
| Q |
213 |
ttggcattttggtttgtaagggaaagtgattcttgttgtcttgggtttgaattggagatgatgatgctgatag |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43568545 |
ttggcattttggtttgtaagggaaagtgattcttgttgtcttcggtttgaattggagatgatgatgctgatag |
43568473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 327 - 357
Target Start/End: Complemental strand, 43568437 - 43568407
Alignment:
| Q |
327 |
aagagagggagataggaccatccacattctt |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43568437 |
aagagagggagataggaccatccacattctt |
43568407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University