View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_high_52 (Length: 312)
Name: NF19425_high_52
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_high_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 211 - 296
Target Start/End: Complemental strand, 1619185 - 1619100
Alignment:
| Q |
211 |
gttcagtgttgggtgatcttgacttctcatcttagatctacccactatgctatttttgcttttcttttcttaatttcattggaatg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1619185 |
gttcagtgttgggtgatcttgacttctcatcttagatctacccactatgctatttttgcttttcttttcttaatttcattggaatg |
1619100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 1619416 - 1619333
Alignment:
| Q |
16 |
aatatatgatagtaaaatagagaaagagataaacaatgggattagggaaaagaacgaggtagaatgggagaagtaagatgaagg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1619416 |
aatatatgatagtaaaatagagaaagagataaacaatgggattagggaaaagaacgaggtagaatgggagaagtaagatgaagg |
1619333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University