View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_high_65 (Length: 255)
Name: NF19425_high_65
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_high_65 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 48255478 - 48255224
Alignment:
| Q |
1 |
taactctatcaactgctgtctctgtatatcttggtatgtgatgtcattcaccatgattagagacataatttaatggttgagagctatatataatttatta |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48255478 |
taactctatcaactgctatctctgtatatcttggtatgtgatgtcattcaccatgattagagacataatttaatggttgagagctatatatcatttatta |
48255379 |
T |
 |
| Q |
101 |
aacaatcaaacatttttatttatttgattctggcagctcaagctattggaattccatttttgagtccatatctacaatcaataggatcttattataaaca |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48255378 |
aacaatcaaacatttatatttatttgattctggcagctcaagctattggaattccatttttgagtccatatctacaatcaataggatcttattataaaca |
48255279 |
T |
 |
| Q |
201 |
tggagccaactatgctacattggcatccactgtgcttctacctaatacttctttg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48255278 |
tggagccaactatgctacattggcatccactgtgcttctacctaatacttctttg |
48255224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University