View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_high_70 (Length: 247)
Name: NF19425_high_70
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_high_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 222
Target Start/End: Complemental strand, 26864834 - 26864633
Alignment:
| Q |
21 |
ccactttcataagctttataaaagatggtaaagtaaaataaaattagaatcctttaatcacgaaattggcaaagattaacgtcttatgtttttggcgttt |
120 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26864834 |
ccactttcataagctatataaaagatggtaaagtaaaataaaattagaatcctttaatcacgaaattggcaaagattaacgtcttatgtttttggcgttt |
26864735 |
T |
 |
| Q |
121 |
ttgtttgccttttatcccataatatttgtgttactgcgcggggttgttggttagttgaaacaaatccatctttgagattaccccacaattagtacaactt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26864734 |
ttgtttgccttttatcccataatatttgtgttactgcgcggggttgttggttagttgaaacaaatccatctttgagattaccccacaattagtacaactt |
26864635 |
T |
 |
| Q |
221 |
ac |
222 |
Q |
| |
|
|| |
|
|
| T |
26864634 |
ac |
26864633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University