View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_high_71 (Length: 246)
Name: NF19425_high_71
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_high_71 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 17993179 - 17993369
Alignment:
| Q |
14 |
cgtttgaagaagattatacaactttcaagtttatgatttttaatgg-ttaaacaacaaatttgggatctaacctttctcaacaatcaccttcgttgtact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17993179 |
cgtttgaagaagattatacaactttcaagtttatgatttttaatgggttaaacaacaaatttgggatctaacctttctcaacaatcaccttcgttgtact |
17993278 |
T |
|
| Q |
113 |
cgaatggtggtataaggtagagagtttgtaggttttcttggtttggatttgtgagtttaatggagaaatgttttctaggcccggtttgcatta |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
17993279 |
cgaatggtggta--aggtagagagtttgtaggttttcttggtttgggtttgtgagtttaatggagaaatgttttctgggccaggtttgcatta |
17993369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 93
Target Start/End: Complemental strand, 19318461 - 19318403
Alignment:
| Q |
35 |
ctttcaagtttatgatttttaat-ggttaaacaacaaatttgggatctaacctttctcaa |
93 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||||||||||| ||||||||||| |
|
|
| T |
19318461 |
ctttcaagtttatgatttttaataggttaaataaaaaatttgggatct-acctttctcaa |
19318403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University