View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_high_72 (Length: 246)
Name: NF19425_high_72
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_high_72 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 11173200 - 11172998
Alignment:
| Q |
1 |
cgagaacaataccttcagtgaaagcctttgtgctatgctgaagttaattggaatcttcatatttgaattgtatgtgtcatatagaaaactttgtttctca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11173200 |
cgagaacaataccttcagtgaa-gcctttgtgctatgctgaagttaattggaatcttcatatttgaattgtatgtgtcatatagaaaactttgtttctca |
11173102 |
T |
 |
| Q |
101 |
tcattggtgaatatggactcataagttaataagttattcggttgagtcggatttttcagttaaatttgtttattggagggtataatgttgttttccatat |
200 |
Q |
| |
|
||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
11173101 |
tcattggtgaatatggattcatatgctaataagttattcggttgagtcggatttttcagttaaatttgtttattggggggtataa---tgttttccatat |
11173005 |
T |
 |
| Q |
201 |
tatatat |
207 |
Q |
| |
|
||||||| |
|
|
| T |
11173004 |
tatatat |
11172998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University