View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_high_81 (Length: 227)
Name: NF19425_high_81
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_high_81 |
 |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |
|
| [»] scaffold0247 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0197 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 3403 - 3629
Alignment:
| Q |
1 |
cttggtcagttggtgactctccttggctccttctcttcactgagcttgaaccaatgtttcttgcctgtggcctaatgatttgaacatctttggatgattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3403 |
cttggtcagttggtgactctccttggctccttctcttcactgagcttgaaccaatgtttcttgcctgtggcctaatgatttgaacatctttggatgattg |
3502 |
T |
 |
| Q |
101 |
tgacctatcttgatcagcttctagagcatttagttttttgcttagatgacagttccaatagtttttcacgtcatttgctgtccttcctggtagccttcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3503 |
tgacctatcttgatcagcttctagagcatttagttttttgcttagatgacagttccaatagtttttcacgtcatttgctgtccttcctggtagccttcct |
3602 |
T |
 |
| Q |
201 |
gcaatcagggaccacctgaagaaaaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3603 |
gcaatcagggaccacctgaagaaaaaa |
3629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0247 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0247
Description:
Target: scaffold0247; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 22219 - 22165
Alignment:
| Q |
153 |
ttccaatagtttttcacgtcatttgctgtccttcctggtagccttcctgcaatca |
207 |
Q |
| |
|
||||||||||||||||| ||||| ||||| || ||||| |||||||| ||||||| |
|
|
| T |
22219 |
ttccaatagtttttcacatcattagctgttctacctggaagccttccagcaatca |
22165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University