View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_low_54 (Length: 308)
Name: NF19425_low_54
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 149 - 290
Target Start/End: Original strand, 13023993 - 13024134
Alignment:
| Q |
149 |
cttaaaccataagtttcttgtatttgattagagtaacaaccattgttcagcccaccagcattattgaatggaattcgtgacgtgtgaagcaatgcttaat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13023993 |
cttaaaccataagtttcttgtatttgattagagtaacaacctttgttcagcccaccagcattattgaatggaattcgtgacgtgtgaagcaatgcttaat |
13024092 |
T |
 |
| Q |
249 |
tagttgagtcgtattattcttcagatgttatctgttgaatct |
290 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
13024093 |
tagttgagtcgtattattcttcacatgttatttgttgaatct |
13024134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 13023855 - 13023887
Alignment:
| Q |
12 |
atgaacgagggagaagcacgatttcgatataac |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13023855 |
atgaacgagggagaagcacgatttcgatataac |
13023887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University