View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_low_58 (Length: 276)
Name: NF19425_low_58
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 14 - 259
Target Start/End: Complemental strand, 43464533 - 43464293
Alignment:
| Q |
14 |
agagcaagaagagctatccatgatgatgagggtgtgatcttaaataagcacatgagtaattaaaggaaaaatgattaaattgtaattatattgaataaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43464533 |
agagcaagaagagctatccatgatgatgagggtgtgatcttaaataagcacatgagtaattaaaggaaaaatgattaaattgtaattatattgaataaag |
43464434 |
T |
|
| Q |
114 |
tgcaattaaggtatctagagtcaagttgcatgcatttgcaacagaaatggctagtagttgagtacaattattggcatggcatagatcatcttttgcagca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43464433 |
tgcaattaaggtatctagagtcaagttgcatgcatttgcaacagaaatggctagtagttgagtacaattattg-----gcatagatcatcttttgcagca |
43464339 |
T |
|
| Q |
214 |
ggaagtcaatccttacgatgattaacatatttggatatgtatattg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43464338 |
ggaagtcaatccttacgatgattaacatatttggataggtatattg |
43464293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University