View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_low_64 (Length: 258)
Name: NF19425_low_64
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_low_64 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 33166763 - 33166544
Alignment:
| Q |
20 |
ttctaaggatgcagttgtacgggggtaaatcaaagagcaaatgttttttggcaaaagaattgcagatggttataatgaacattgtggtcatttctttgca |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
33166763 |
ttctaaggatgcagttgtacaggggtaaatcaaagagcaaatgttttttggcaaaagaattgcagatggttataatgaacattgtggttatttccttgca |
33166664 |
T |
|
| Q |
120 |
aagggcccagtacaactaaaatctcgatggtcgaaggtgaattccataattaaaaaatttggagggtgctacaagcaagcctatccaagaagnnnnnnng |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33166663 |
aagggaccagtacaactaaaatctcgatggtcgaaggtgaattccataattaaaaaatttggagggtgctacaagcaagcctatccaagaagaaaaaaag |
33166564 |
T |
|
| Q |
220 |
tggtagcttatagtgatgtc |
239 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
33166563 |
tggtagcttagagtgatgtc |
33166544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University