View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_low_87 (Length: 216)
Name: NF19425_low_87
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_low_87 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 35 - 199
Target Start/End: Original strand, 39674992 - 39675157
Alignment:
| Q |
35 |
taggttttatattgcaaataacccatccttacaaaatcgtaaggcaggtatcactcattttaaa-tttatttttatcctattgccactttgattannnnn |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39674992 |
taggttttatattgcaaataacccatccttacaaaatcgtaaggcaggtatcactcattttaaattttatttttatcctattgccactttgattattttt |
39675091 |
T |
 |
| Q |
134 |
nnctttctaatatatctcattcgtgtctattacctttttaattagatgcgtaaatataaacgatag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
39675092 |
ttctttctaatatatctcattcgtgtctattaccttttaaattagatgcataaatataaacgatag |
39675157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University