View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19425_low_89 (Length: 213)
Name: NF19425_low_89
Description: NF19425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19425_low_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 26691334 - 26691518
Alignment:
| Q |
18 |
gaacatcctaatgtgaagcgtgggagttattcaggcttgggaagtccaaaatattaaacnnnnnnnnnn----attgaatgtaagttaaggttaagcttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26691334 |
gaacatcctaatgtgaagcgtgggagttattcaggcttgggaagtccaaaatattaaacttttttttttttttattgaatgtaagttaaggttaagcttt |
26691433 |
T |
 |
| Q |
114 |
atcttgattgattttattattatttttgaactct--ttnnnnnnnntggttgaattagtgtattgggggttatcacaaaatttgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26691434 |
atcttgattgattttattattatttttgaactctccaaaaaaaaaatggttgaattagtgtattgggggttatcacaaaatttgt |
26691518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University