View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19426_low_10 (Length: 236)
Name: NF19426_low_10
Description: NF19426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19426_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 78 - 217
Target Start/End: Complemental strand, 5663734 - 5663595
Alignment:
| Q |
78 |
caattaacagtatacagaagcagctctattgaaaattgactgcattgataaaaaatcacaacaacagtagcataaaaacaattagaaataaatcaagtac |
177 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
5663734 |
caattaaaaatatacagaagcagctctattgaaaattgactgcattgataaaaaatgacaacaacagtagcataaaaaccattagaaataaatcaaggac |
5663635 |
T |
 |
| Q |
178 |
aatagaataaacctattttggattctactcaatgccaaac |
217 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
5663634 |
aatagaataaacctgtttttgattctactcaatgccaaac |
5663595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University