View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19426_low_15 (Length: 210)

Name: NF19426_low_15
Description: NF19426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19426_low_15
NF19426_low_15
[»] chr8 (3 HSPs)
chr8 (1-76)||(7803852-7803927)
chr8 (1-76)||(7833250-7833322)
chr8 (1-58)||(7783802-7783859)


Alignment Details
Target: chr8 (Bit Score: 56; Significance: 2e-23; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 7803927 - 7803852
Alignment:
1 catgggaaatagagtatgaatcagagttgatggctgttctggttttctataaggaagtcaaaaggcccttattaat 76  Q
    ||||||||||||||||||||| ||||||||||| ||||||||||||||| | ||||||||||||||||||| ||||    
7803927 catgggaaatagagtatgaataagagttgatggttgttctggttttctagatggaagtcaaaaggcccttactaat 7803852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 7833322 - 7833250
Alignment:
1 catgggaaatagagtatgaatcagagttgatggctgttctggttttctataaggaagtcaaaaggcccttattaat 76  Q
    ||||||||||||||||||||||||||||||||   |||||||||||||| | ||||||||||||||| ||||||||    
7833322 catgggaaatagagtatgaatcagagttgatg---gttctggttttctagatggaagtcaaaaggccattattaat 7833250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 7783859 - 7783802
Alignment:
1 catgggaaatagagtatgaatcagagttgatggctgttctggttttctataaggaagt 58  Q
    ||||||||||||||||||||| ||||||||||| ||||||||||||||| | ||||||    
7783859 catgggaaatagagtatgaataagagttgatggttgttctggttttctagatggaagt 7783802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University