View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19426_low_5 (Length: 336)
Name: NF19426_low_5
Description: NF19426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19426_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 176 - 328
Target Start/End: Complemental strand, 50348901 - 50348749
Alignment:
| Q |
176 |
gataaaagtttttactttaaacttcttaacaaatgtcattgttttcctttatttaaatacgcagaaatcatgtcctcctatattttaattggtaactctt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50348901 |
gataaaagtttttactttaaacttcttaacaaatgtcattgttttcctttatttaaatacgtagaaatcatgtcctcctatattttaattagtaactctt |
50348802 |
T |
 |
| Q |
276 |
caagattgtttcctnnnnnnnncgagtttgggtatgctccatttacctttgct |
328 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
50348801 |
caagattgtttcctaaaaaaaacgagtttgggtatgctcaatttacctttgct |
50348749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 16 - 85
Target Start/End: Complemental strand, 50349061 - 50348992
Alignment:
| Q |
16 |
ggaacagtcatttcttgttgaaccttcgtcttagattcacttattagctgacaatgaggattgttaagtg |
85 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50349061 |
ggaatagtcatttcttgttgaaccttcgtcttagattcacttaatagctgacaatgaggattgttaagtg |
50348992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University