View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19426_low_9 (Length: 237)
Name: NF19426_low_9
Description: NF19426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19426_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 47373365 - 47373246
Alignment:
| Q |
1 |
gagtcttgaattgtgcacagaaaatcttggcaacgagagtggtactgacactgtagaaaacgacatattgttgtcttcaatgggaacaatggagcaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47373365 |
gagtcttgaattgtgcacagaaaatcttggcaacgagagtggtactgacattgtagaaaacgacttattgttgtcttcaatgggaacaatggagcaaaga |
47373266 |
T |
|
| Q |
101 |
caaccttgttctcaagtttt |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47373265 |
caaccttgttctcaagtttt |
47373246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 94
Target Start/End: Original strand, 47385568 - 47385657
Alignment:
| Q |
5 |
cttgaattgtgcacagaaaatcttggcaacgagagtggtactgacactgtagaaaacgacatattgttgtcttcaatgggaacaatggag |
94 |
Q |
| |
|
|||||||| || || || |||||||| || || ||||| ||||||| ||||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
47385568 |
cttgaattatgtacggagaatcttggtaatgaaagtggcactgacattgtagaaaatgacatgttgttgtcttcaatgggagcaatggag |
47385657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University