View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19428_high_15 (Length: 248)
Name: NF19428_high_15
Description: NF19428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19428_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 80 - 201
Target Start/End: Complemental strand, 46340873 - 46340752
Alignment:
| Q |
80 |
ataaaggatgtgagatggaatagcttgatctctggtaccaggaataagagttagctttccttccgttaccagcttagtgatgtgtctactgatgacttcc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46340873 |
ataaaggatgtgagatggaatagcttgacctctggtaccaggaataagagttagctttccttcccttaccagcttagtgatgtgtctactaatgacttcc |
46340774 |
T |
|
| Q |
180 |
tatgcaaggcaaaataaaagag |
201 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46340773 |
tatgcaaggcaaaataaaagag |
46340752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 85
Target Start/End: Complemental strand, 27459609 - 27459573
Alignment:
| Q |
49 |
ttcctttgcaaaaaagcattatatcatctgcataaag |
85 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
27459609 |
ttcctttgcaaaagatcattatatcatctgcataaag |
27459573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University