View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19428_low_16 (Length: 244)
Name: NF19428_low_16
Description: NF19428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19428_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 123 - 228
Target Start/End: Complemental strand, 36965474 - 36965369
Alignment:
| Q |
123 |
aatgtgtcccttgatcagggaaatgagatcataactcacaagcaagtatacacacggcgttaaaaaatatggcgtttttaccttgtagaatgtgaggtgg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36965474 |
aatgtgtcccttgatcagggaaatgagatcataactcacaagcaagtatacacacggcgttaaaaaatatggcgtttttaccttgtagaatgtgaggtgg |
36965375 |
T |
|
| Q |
223 |
taaaga |
228 |
Q |
| |
|
|||||| |
|
|
| T |
36965374 |
taaaga |
36965369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 3 - 57
Target Start/End: Complemental strand, 36965527 - 36965473
Alignment:
| Q |
3 |
aaaaggatataatctttttgacaaatatacaacaaatttacttgatcatcaagaa |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36965527 |
aaaaggatataatctttttgacaaatatacaacaaatttacttgatcatcaagaa |
36965473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University