View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1942_low_14 (Length: 273)
Name: NF1942_low_14
Description: NF1942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1942_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 6323028 - 6323216
Alignment:
| Q |
15 |
tctgtgatcttaactttaagaaatgtcaattccaacttgcattttatggctgatgtatt-attcaacacagaaactgtatatatgtgtagttgctaaaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
6323028 |
tctgtgatcttaactttaagaaatgttaattcaaacttgcattttatggctgatgtatttattcaacacagaaactgtatacatgagtagttgctaaaga |
6323127 |
T |
|
| Q |
114 |
actattaatgaataataaggcacacaatacacattatttttgttaaacagtagaggc-gaaaaacacactcagttggttttgttcttttaaat |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| | |||||| | |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6323128 |
actattaatgaataataaggcacaaaatacacattatttttgt----cggtagagtcggaaaaacacactgagttggttttgttctttcaaat |
6323216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University