View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1942_low_17 (Length: 212)
Name: NF1942_low_17
Description: NF1942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1942_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 198
Target Start/End: Complemental strand, 26684376 - 26684193
Alignment:
| Q |
15 |
ataattctttgctgattgtattgtatgtaaaacttgcatatgttactctttttagtgtgtcatgtgttctgtgtaataaaataagcacacacattgcaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26684376 |
ataattctttgctgattgtattgtatgtaaaacttgcatatgttactctttttagtgtgtcatgtgttctgtgtaataaaataagcacacacattgcaga |
26684277 |
T |
|
| Q |
115 |
tatgtttgtttcctcctgattgattgcattgtgtagttatagcattcagagactcctactgctggaattggcaacataggagac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26684276 |
tatgtttgtttcctcctgattgattgcattgtgtagttttagcattcagagactcctactgctggaattggcaacataggagac |
26684193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University