View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1942_low_18 (Length: 206)
Name: NF1942_low_18
Description: NF1942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1942_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 44 - 206
Target Start/End: Complemental strand, 28440914 - 28440752
Alignment:
| Q |
44 |
tgatggaaaactgattagtgttgatttgacttttaaaggggaggctcatggatggatcatttgtggcagtgaaagtgctttctgttgagactgaatctat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28440914 |
tgatggaaaactgattagtgttgatttgacttttaaaggggaggctcatggatggatcatttgtggcagtgaaagtgctttctgttgagactgaatctat |
28440815 |
T |
 |
| Q |
144 |
gagaggagagagggaatttgttgcagaattggctgcactagcaaatataaagcaccaaaatct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28440814 |
gagaggagagagggaatttgttgcagaattggctgcactatcaaatataaagcaccaaaatct |
28440752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University