View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19430_high_17 (Length: 232)
Name: NF19430_high_17
Description: NF19430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19430_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 213
Target Start/End: Complemental strand, 46985457 - 46985257
Alignment:
| Q |
13 |
gagatgaaaagggtcaccaaggaaactaatgtatcagtcaaaattaacttggatggaactggggttgctgataacagttctggaattccctttcttgatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46985457 |
gagatgaaaagggtcaccaaggaaactaatgtatcagtcaaaattaacttggatggaactggggttgctgataacagttctggaattccctttcttgatc |
46985358 |
T |
|
| Q |
113 |
atatgcttgatgttagtgttttcaactcaattgatgttatgcttttgttattttttatctattaaaccctaacacatacaccaaacaccgacacttagtc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
46985357 |
atatgcttgatgttagtgttttcaactcaattgatgttatgcttttgttattttttatctattaaacactaacacatacaccgaacaccgacacttagtc |
46985258 |
T |
|
| Q |
213 |
a |
213 |
Q |
| |
|
| |
|
|
| T |
46985257 |
a |
46985257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 144
Target Start/End: Complemental strand, 31685468 - 31685386
Alignment:
| Q |
62 |
tggatggaactggggttgctgataacagttctggaattccctttcttgatcatatgcttgatgttagtgttttcaactcaatt |
144 |
Q |
| |
|
|||||||||||||||| |||||| |||||| || || | || ||||||||||||| | |||| ||| |||||||||||||| |
|
|
| T |
31685468 |
tggatggaactggggtagctgatgctagttctcgagtttctttccttgatcatatgccttatgtcagtattttcaactcaatt |
31685386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University