View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19430_high_21 (Length: 203)

Name: NF19430_high_21
Description: NF19430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19430_high_21
NF19430_high_21
[»] chr1 (1 HSPs)
chr1 (18-184)||(35095843-35096009)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 35096009 - 35095843
Alignment:
18 atgaatgcaattgagatagcttacaacaaaggctggactaatctatggttagaaactgattcgacattggttctgttaagtcttcgtcctttgttccata 117  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
35096009 atgaatgcaattgagatagcttacaataaaggctggactaatctatggttagaaactgattcgacattggttctgttaagccttcgtcctttgttccata 35095910  T
118 aaacataaggaatagatgggaaaattgcattgatttaacaaaacaaatgaacttcatagtctctcgt 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35095909 aaacataaggaatagatgggaaaattgcattgatttaacaaaacaaatgaacttcatagtctctcgt 35095843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University