View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19430_high_8 (Length: 349)
Name: NF19430_high_8
Description: NF19430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19430_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 32686925 - 32687185
Alignment:
| Q |
13 |
catagggccatgcgagctgttttattttatttcttttgggttttgattgagaccatctaaaggactacttatgcacatggtttgaaattgacaactaaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32686925 |
catagggccatgcgagctgttttattttatttcttttgggttttgattgagaccatctaaaggactacttatgcacatggtttgaaattgacaactaaat |
32687024 |
T |
|
| Q |
113 |
gatgttgtacggttggaaataattcaatgttttaaaagtcggattgagccggccggttcaaccaatttgtcgacttggtttaactcggattatcatgtat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32687025 |
gatgttgtacggttggaaataattcaatgtttgaaaaatcggattgagccggccggttcaatcaatttgtcgacttggtttgactcggattatcatgtat |
32687124 |
T |
|
| Q |
213 |
tcttgctcaacatagttaaatgggagttagattgagttgaattgtgattgaatcgtgattggttcatcaac |
283 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32687125 |
tcttgctcaacatagttaaatgg----------gagttgaattgtgattgaatcgtgattggttcatcaac |
32687185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University