View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19430_low_15 (Length: 300)
Name: NF19430_low_15
Description: NF19430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19430_low_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 29607229 - 29606918
Alignment:
| Q |
1 |
tctgaactcattgtagtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607229 |
tctgaactcattgtagtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtg |
29607130 |
T |
 |
| Q |
101 |
cgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgct----- |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607129 |
cgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgc |
29607030 |
T |
 |
| Q |
196 |
-------ggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607029 |
tgatgatggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgt |
29606930 |
T |
 |
| Q |
289 |
gtaggtgctggt |
300 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29606929 |
gtaggtgctggt |
29606918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University