View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19430_low_20 (Length: 250)
Name: NF19430_low_20
Description: NF19430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19430_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 214
Target Start/End: Complemental strand, 1184829 - 1184622
Alignment:
| Q |
7 |
ttagggtcttcagaagtgtttccaattcctttggatgaaaataaagagagtattgaagacgtgattaaccaacagtttcaaataaagaaagtaggcgagg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |||| |
|
|
| T |
1184829 |
ttagggtcttcagaagtgtttccaattcctttggatgaaaataaagagagtattgaagacgtgattaaccaacaatttcaagtaaagaaagtaggtgagg |
1184730 |
T |
 |
| Q |
107 |
aagatgcaaaagagaagcatcacaacaacgtggaagctatagaatttcaatgcgtgctgtgaaagtgtgaccatattatatactctctcactgttttgtg |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1184729 |
aagatgcaaaagagaagcatgacaacaacgtggaagctatagaatttcaatgcgtggtgtaaaagtgtgaccatattatatactctctcactgttttgtg |
1184630 |
T |
 |
| Q |
207 |
aaagaaag |
214 |
Q |
| |
|
|||||||| |
|
|
| T |
1184629 |
aaagaaag |
1184622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University