View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19430_low_7 (Length: 468)
Name: NF19430_low_7
Description: NF19430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19430_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 3590648 - 3590853
Alignment:
| Q |
8 |
acgacaatgtttatcactatctaaaatagcattctccaaaatattaagtttttcccacattgatcaaaaagtatgcataaccagaaaacaaaagtagaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590648 |
acgacaatgtttatcactatctaaaatagcattctccaaaatattaagtttttcccacattgatcaaaaagtatgcataaccagaaaacaaaagtagaaa |
3590747 |
T |
 |
| Q |
108 |
taaatttcatatctttggcagcactataccttttatccgaaaattcaaaacctacactcatacatacagccattaaaagttactgccgtctatcttgtct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3590748 |
taaatttcatatctttggcagcactataccttttatccgaaaattcaaaacctacactcatacatacagccattgaaagttactgccgtctatcttgtct |
3590847 |
T |
 |
| Q |
208 |
tggggg |
213 |
Q |
| |
|
|||||| |
|
|
| T |
3590848 |
tggggg |
3590853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University