View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19431_high_17 (Length: 265)
Name: NF19431_high_17
Description: NF19431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19431_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 34480290 - 34480051
Alignment:
| Q |
18 |
atgtaagacatgcatccatatcctaatttaatatcatatggttcaactttcacttcatcaacttctgttggaatgagaaaacctttgcttgcttccattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34480290 |
atgtaagacatgcatccatatcctaatttaatatcatatggttcaactttcacttcatcaacttctgttggaatgagaaaacctttgcttgcttccattg |
34480191 |
T |
|
| Q |
118 |
cattcttcttcaattccttcacttgactaatcacttcagcaagtattgtggctttatccatctaaagagttatgaaacattgacccacaaaatcaaattc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34480190 |
cattcttcttcaattccttcacttgactaatcacttcagcaagtattgtggctttatccatctaaagagttatgaaacattgacccacaaaatcaaattc |
34480091 |
T |
|
| Q |
218 |
aacacattttatagttttgaattgcttaaataatattctt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34480090 |
aacacattttatagttttgaattgcttaaataattttctt |
34480051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 51 - 181
Target Start/End: Original strand, 4770556 - 4770686
Alignment:
| Q |
51 |
tcatatggttcaactttcacttcatcaacttctgttggaatgagaaaacctttgcttgcttccattgcattcttcttcaattccttcacttgactaatca |
150 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||| | |||||||||||||||| |||||| || ||||| | ||||||||| ||||| | |
|
|
| T |
4770556 |
tcatatggttcaactttcacttcatcatcgtctgttggaattgaataacctttgcttgcttcatctgcattttttttcaaatgcttcacttgcctaataa |
4770655 |
T |
|
| Q |
151 |
cttcagcaagtattgtggctttatccatcta |
181 |
Q |
| |
|
| ||||| |||| || ||||| |||||||| |
|
|
| T |
4770656 |
cctcagctagtaaagttgctttgtccatcta |
4770686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University