View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19431_low_20 (Length: 252)
Name: NF19431_low_20
Description: NF19431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19431_low_20 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 252
Target Start/End: Original strand, 34479365 - 34479603
Alignment:
| Q |
14 |
atgaagaaaagtataaaacattaaacactaatgtcaattttgacaaggtgtattttaatttgatgtctttgtcnnnnnnnnnnnnnnnnnnnnnnnnnca |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34479365 |
atgaacaaaagtataaaacattaaacactaatgtcaattttgacaaggtgtattttaatttgatgtctttgtcaaaggaaaagaaaaaagagaagaaaca |
34479464 |
T |
 |
| Q |
114 |
ttttcattgtaatcaaattgattaaaatattgctttcaagttttgttgtggacatgccagttaatttattcttctggatggtatgagatagtcagtcagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
34479465 |
ttttcattgtaatcaaattgattaaaatattgctttcaagttttgttgtggacatgccagttaatttattcttctggatggtatgacacagtcagtcagt |
34479564 |
T |
 |
| Q |
214 |
ttcttgagctattttagttgcaccgccatcttatcttta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34479565 |
ttcttgagctattttagttgcaccgccatcttatcttta |
34479603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 114 - 170
Target Start/End: Original strand, 34489794 - 34489852
Alignment:
| Q |
114 |
ttttcattgtaatcaaattgattaaaatat--tgctttcaagttttgttgtggacatgc |
170 |
Q |
| |
|
||||||||| ||||| ||||||||| |||| |||||| |||||||||||||||||||| |
|
|
| T |
34489794 |
ttttcattgcaatcagattgattaagatatattgctttaaagttttgttgtggacatgc |
34489852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University