View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19431_low_5 (Length: 393)
Name: NF19431_low_5
Description: NF19431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19431_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 35354832 - 35354590
Alignment:
| Q |
7 |
tcgaagaatatcagaaaagggtgagtgatctaattggtaaaaaagaagctaagaaattaataaatggagcactaatccttattacatgtggaggtaatga |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354832 |
tcgaagaataccagaaaagggtgagtgatctaattggtaaaaaagaagctaagaaattaataaatggagcactaatccttattacatgtggaggtaatga |
35354733 |
T |
|
| Q |
107 |
ttttgtgaataactactacttggtgccaaactccctaagatcccgccagtatgctttaccagaatatgtcacgtatttgctctctgagtacaagaagatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354732 |
ttttgtgaataactactacttggtgccaaactccctaagatcccgccagtatgctttaccagaatatgtcacgtatttgctctctgagtacaagaagatt |
35354633 |
T |
|
| Q |
207 |
ttacgggtaatttttatattttatgtgtgcatgcttttcttcg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35354632 |
ttacgggtaatttttatattttatgtgtgcatgattttcttcg |
35354590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 102 - 133
Target Start/End: Complemental strand, 7386936 - 7386905
Alignment:
| Q |
102 |
aatgattttgtgaataactactacttggtgcc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7386936 |
aatgattttgtgaataactactacttggtgcc |
7386905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University