View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19431_low_6 (Length: 377)
Name: NF19431_low_6
Description: NF19431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19431_low_6 |
 |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 2e-74; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 146 - 359
Target Start/End: Complemental strand, 12778941 - 12778728
Alignment:
| Q |
146 |
tgtcacttcaatgccttcatcagatatatagagacagttccaaaacacaattgattgaacactatcta--attcaacaaactaatcgaggttgaatacag |
243 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
12778941 |
tgtcacttcaatgcttccatcagatatatagagacagctccaaaacacaattgattgaacactatctataattcaacaaactaatccaggttgaatacag |
12778842 |
T |
 |
| Q |
244 |
agcttggaaacaaaaaacaatgtcctctcacttcacttaatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctc |
343 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||| |||||||| ||||||||| ||| | ||| |
|
|
| T |
12778841 |
agcttagaaacaaaaaacaatgtcctctcatttcacttaatgggatccaagagggttgtctcttgttcattggaggagtcaacatgcaaagga--aactc |
12778744 |
T |
 |
| Q |
344 |
tatcataatgagaatt |
359 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
12778743 |
tatcagaatgagaatt |
12778728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 65
Target Start/End: Complemental strand, 12779042 - 12778987
Alignment:
| Q |
10 |
agataatactttcactagtacaatttaaagtcttggtatcaagtttcacatagcta |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12779042 |
agataatactttcactagtacaatttaaagtcttggtatcaagtttcgcatagcta |
12778987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 357
Target Start/End: Original strand, 22873501 - 22873576
Alignment:
| Q |
282 |
aatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
||||||||| | |||||| ||||||||||||| |||||||| || ||||| |||||| ||| |||||||||||||| |
|
|
| T |
22873501 |
aatgggatccaggagggttgtctcttgttcattggaggagtcaatatgcatgggaagctctttatcataatgagaa |
22873576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 275 - 357
Target Start/End: Complemental strand, 34374190 - 34374108
Alignment:
| Q |
275 |
ttcacttaatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||||||||||| ||| |||| |||||||| ||||| ||| ||||| |||||||| |
|
|
| T |
34374190 |
ttcactcaatgggatccaagagagtggtctcttgttcattggaagagtcaacatgcatgggaatctctttatcaaaatgagaa |
34374108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 275 - 331
Target Start/End: Original strand, 18203119 - 18203175
Alignment:
| Q |
275 |
ttcacttaatgggatctaagagggtggtctcttgttcatcggaggagttaacatgca |
331 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
18203119 |
ttcactgaatgggatctaggagggtggtctcttgttcattcgaggagtcaacatgca |
18203175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 294 - 357
Target Start/End: Original strand, 22888956 - 22889019
Alignment:
| Q |
294 |
gagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
|||||| ||||||||||||| |||||||| || ||||| |||||| ||| |||||||||||||| |
|
|
| T |
22888956 |
gagggttgtctcttgttcattggaggagtcaatatgcatgggaagctctttatcataatgagaa |
22889019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 294 - 357
Target Start/End: Original strand, 22910499 - 22910562
Alignment:
| Q |
294 |
gagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
|||||| ||||||||||||| |||||||| || || || |||||| ||| |||||||||||||| |
|
|
| T |
22910499 |
gagggttgtctcttgttcattggaggagtcaatatacatgggaagctctttatcataatgagaa |
22910562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 146 - 206
Target Start/End: Original strand, 18840378 - 18840438
Alignment:
| Q |
146 |
tgtcacttcaatgccttcatcagatatatagagacagttccaaaacacaattgattgaaca |
206 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
18840378 |
tgtcacttcaatgctttcatcagatacatagagaaagttccaaaacacaattgattgaaca |
18840438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 275 - 357
Target Start/End: Original strand, 18252102 - 18252184
Alignment:
| Q |
275 |
ttcacttaatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||| ||| |||||||| ||||||| || ||| | | |||||||||||||| |
|
|
| T |
18252102 |
ttcactaaatgggattcaggagggtggtctcttgtccattggaggagtccacatgcatggaaagctgtttatcataatgagaa |
18252184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 275 - 359
Target Start/End: Complemental strand, 11001229 - 11001145
Alignment:
| Q |
275 |
ttcacttaatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaatt |
359 |
Q |
| |
|
|||||| ||||||||| | |||| || |||||| ||||| ||||||||||||||||| |||||| ||| ||||| |||||||||| |
|
|
| T |
11001229 |
ttcactcaatgggatccaggaggatgatctctttttcattggaggagttaacatgcatgggaagctctttatcacaatgagaatt |
11001145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 8915568 - 8915514
Alignment:
| Q |
282 |
aatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaaggga |
336 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
8915568 |
aatggcatctagaaggttggtctcttgttcatcggaggagtcaacatgcatggga |
8915514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 269 - 357
Target Start/End: Complemental strand, 32162375 - 32162288
Alignment:
| Q |
269 |
tctcacttcacttaatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
||||| |||||| ||||||||| | |||||||||||||||||||| || |||| |||||||| |||||| ||| ||||| |||||||| |
|
|
| T |
32162375 |
tctcatttcactcaatgggatcaaggagggtggtctcttgttcattaga-gagtcaacatgcatgggaagctctttatcagaatgagaa |
32162288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 294 - 357
Target Start/End: Original strand, 22716315 - 22716378
Alignment:
| Q |
294 |
gagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||| | |||||| ||| ||||| |||||||| |
|
|
| T |
22716315 |
gagggtggtctcttgttcattggaggagtcaacatgaatgggaagctctttatcaaaatgagaa |
22716378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 294 - 357
Target Start/End: Complemental strand, 22988902 - 22988839
Alignment:
| Q |
294 |
gagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||| | |||||| ||| ||||| |||||||| |
|
|
| T |
22988902 |
gagggtggtctcttgttcattggaggagtcaacatgaatgggaagctctttatcaaaatgagaa |
22988839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 294 - 357
Target Start/End: Original strand, 10352 - 10415
Alignment:
| Q |
294 |
gagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
|||||| ||||||||||||| |||||||| || || || |||||| ||| |||||||||||||| |
|
|
| T |
10352 |
gagggttgtctcttgttcattggaggagtcaatattcatgggaagctctttatcataatgagaa |
10415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 282 - 357
Target Start/End: Complemental strand, 24577926 - 24577851
Alignment:
| Q |
282 |
aatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaagggaagatctctatcataatgagaa |
357 |
Q |
| |
|
||||||||||| |||| |||||||||||| || |||||||| || ||||||| |||| ||| ||||| || ||||| |
|
|
| T |
24577926 |
aatgggatctaggaggatggtctcttgtttattggaggagtaaatatgcaagcgaagttctgtatcagaaggagaa |
24577851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 338
Target Start/End: Original strand, 23988914 - 23988970
Alignment:
| Q |
282 |
aatgggatctaagagggtggtctcttgttcatcggaggagttaacatgcaagggaag |
338 |
Q |
| |
|
||||||||| | |||||| ||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
23988914 |
aatgggatccagaagggtgatctcttgctcattgaaggagttaacatgcaagggaag |
23988970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University